Sequence retrieval

Genome: Cryptobacterium curtum DSM 15641
Start position: 1295923
End position: 1295967
Length: 45

DNA sequence
>NC_013170, from 1295923 to 1295967 (45 bp); Cryptobacterium curtum DSM 15641 GTAGGCTCACTGCTAGTAGACTCACCACTACTAGGCTCACTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1295257-1296699	Sequence	Ccur_11380 - glycosyltransferase (Protein is coded in complementary strand; from 1296699 to 1295257)