Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5175130
End position: 5175192
Length: 63

DNA sequence
>NC_012988, from 5175130 to 5175192 (63 bp); Methylobacterium extorquens DM4 CGGCGTGGTTCAAGGGGCTCGCGGCGTGGTTCAAGGGGCTCGCGGCGTGGTTCAAGGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5174341-5175375	Sequence	METDI5250 - phage DNA polymerase (Protein is coded in complementary strand; from 5175375 to 5174341)