Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5320476
End position: 5320529
Length: 54

DNA sequence
>NC_012988, from 5320476 to 5320529 (54 bp); Methylobacterium extorquens DM4 ATGCAGACCATGTAGACGATGCACACCGTGCAGACGATGACCACCATGTAGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5318292-5320712	Sequence	METDI5378 - hypothetical protein (Protein is coded in complementary strand; from 5320712 to 5318292)