Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 3007206
End position: 3007253
Length: 48

DNA sequence
>NC_012988, from 3007206 to 3007253 (48 bp); Methylobacterium extorquens DM4 GGCATGAGTTCCGGCAGGGGTTCCGGCACGAGTTCGGGCAACAGTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3007056-3008753	Sequence	METDI3091 - hypothetical protein (Protein is coded in complementary strand; from 3008753 to 3007056)