Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2939835
End position: 2939882
Length: 48

DNA sequence
>NC_012988, from 2939835 to 2939882 (48 bp); Methylobacterium extorquens DM4 CCGCCGCGGTCGCCGCCGCGATCACCACCCCGGTCGCCGCCGCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2939721-2940287	Sequence	METDI3020 ssb Single-stranded DNA-binding protein (Protein is coded in complementary strand; from 2940287 to 2939721)