Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 983171
End position: 983215
Length: 45

DNA sequence
>NC_012988, from 983171 to 983215 (45 bp); Methylobacterium extorquens DM4 GGATCGCTCTTGCCGGGCTCGCTCTTGACGGGTTCGCTTTTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 983066-985363	Sequence	METDI1071 - penicillin-binding protein (Protein is coded in complementary strand; from 985363 to 983066)