Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 585640
End position: 585684
Length: 45

DNA sequence
>NC_012988, from 585640 to 585684 (45 bp); Methylobacterium extorquens DM4 AGCGACGGCGCCCGAGGAGACGGCGTCCGAAGGGACGGGGCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 584627-585706	Sequence	METDI0618 fliG flagellar motor switch protein FliG (Protein is coded in complementary strand; from 585706 to 584627)