Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5161553
End position: 5161597
Length: 45

DNA sequence
>NC_012988, from 5161553 to 5161597 (45 bp); Methylobacterium extorquens DM4 TTCCGCGGCCTTGGCTTCGGCCGCCTTGGCCTCGGCGACCTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5160801-5162168	Sequence	METDI5234 - hypothetical protein (Protein is coded in complementary strand; from 5162168 to 5160801)