Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4538668
End position: 4538712
Length: 45

DNA sequence
>NC_012988, from 4538668 to 4538712 (45 bp); Methylobacterium extorquens DM4 TCCTCCGAGTCCTCGTCGTCCGAATCGTCGGCCTCGGCGTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4536403-4539564	Sequence	METDI4658 - ribonuclease E or G (Protein is coded in complementary strand; from 4539564 to 4536403)