Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2410945
End position: 2410989
Length: 45

DNA sequence
>NC_012988, from 2410945 to 2410989 (45 bp); Methylobacterium extorquens DM4 GCGGCGAGCATCGCAGCCGCGAGCAGCGCGGCGGCGAGCGCCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2410642-2411007	Sequence	METDI2498 - hypothetical protein (Protein is coded in complementary strand; from 2411007 to 2410642)
ORF... 2410988-2411722	Sequence	METDI2499 - hypothetical protein (Protein is coded in complementary strand; from 2411722 to 2410988)