Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2112559
End position: 2112603
Length: 45

DNA sequence
>NC_012988, from 2112559 to 2112603 (45 bp); Methylobacterium extorquens DM4 GCCCCCGCCAAGCCTGCCCCACTCAAGCCTGTCCCCCTCAAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2112293-2113078	Sequence	METDI2227 - Smr protein/MutS2 C-terminal, damaged DNA binding, mismatch repair