Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4505585
End position: 4505626
Length: 42

DNA sequence
>NC_012988, from 4505585 to 4505626 (42 bp); Methylobacterium extorquens DM4 GGCCCCATGACCATCGCGCCATGACCATCGCGCCATGACCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4505620-4506714	Sequence	METDI4629 modC molybdate ABC transporter ATP-binding protein