Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 86516
End position: 86551
Length: 36

DNA sequence
>NC_012988, from 86516 to 86551 (36 bp); Methylobacterium extorquens DM4 CAAGTCCTGATGCAAGCCCTGCTGCAAGCCCGGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 85417-86526	Sequence	METDI0087 - metal dependent phosphohydrolase with a response regulator receiver domain; HD-GYP domain-containing protein