Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 643005
End position: 643040
Length: 36

DNA sequence
>NC_012988, from 643005 to 643040 (36 bp); Methylobacterium extorquens DM4 CGGGCTTGGGCGCGGGCTTGCGCTCGGCCTTGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 642746-643495	Sequence	METDI0680 - hypothetical protein (Protein is coded in complementary strand; from 643495 to 642746)