Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 587772
End position: 587807
Length: 36

DNA sequence
>NC_012988, from 587772 to 587807 (36 bp); Methylobacterium extorquens DM4 CTCGGGGGCCGCCTCGGGGGCTCCCGCGGGGGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 586822-587844	Sequence	METDI0622 fliM flagellar motor switch protein FliM (Protein is coded in complementary strand; from 587844 to 586822)