Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5613846
End position: 5613881
Length: 36

DNA sequence
>NC_012988, from 5613846 to 5613881 (36 bp); Methylobacterium extorquens DM4 GGGTTCGGCCCAGGATTTGGCCCAGGGTTCGGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5612379-5614445	Sequence	METDI5640 - hypothetical protein (Protein is coded in complementary strand; from 5614445 to 5612379)