Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5255787
End position: 5255822
Length: 36

DNA sequence
>NC_012988, from 5255787 to 5255822 (36 bp); Methylobacterium extorquens DM4 CCCGCGCCCATGCCCGCTCCCGTGCCGGCTCCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5255760-5256206	Sequence	METDI5324 - hypothetical protein (Protein is coded in complementary strand; from 5256206 to 5255760)