Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5112834
End position: 5112869
Length: 36

DNA sequence
>NC_012988, from 5112834 to 5112869 (36 bp); Methylobacterium extorquens DM4 CTGGGCCCCTTCCTGAGCCCGTTCCTGAGCCCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5112829-5113836	Sequence	METDI5194 potH putrescine ABC transporter (Protein is coded in complementary strand; from 5113836 to 5112829)