Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4735658
End position: 4735693
Length: 36

DNA sequence
>NC_012988, from 4735658 to 4735693 (36 bp); Methylobacterium extorquens DM4 GCCACCACCGGGGCGTCCACCGGGGGCACCGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4735599-4737608	Sequence	METDI4845 - hypothetical protein (Protein is coded in complementary strand; from 4737608 to 4735599)