Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4560523
End position: 4560558
Length: 36

DNA sequence
>NC_012988, from 4560523 to 4560558 (36 bp); Methylobacterium extorquens DM4 GCCGGCCTCCATGCCGGCCTCCATGCCGGCCTCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4560450-4562636	Sequence	METDI4677 - membrane-associated glycosyl transferase