Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4039037
End position: 4039072
Length: 36

DNA sequence
>NC_012988, from 4039037 to 4039072 (36 bp); Methylobacterium extorquens DM4 CATTTGGCCGCCCATCTGGCCACCCATTTGCCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4038882-4039193	Sequence	METDI4103 - hypothetical protein (Protein is coded in complementary strand; from 4039193 to 4038882)