Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 3666388
End position: 3666423
Length: 36

DNA sequence
>NC_012988, from 3666388 to 3666423 (36 bp); Methylobacterium extorquens DM4 ATGACTCCTTGCATGGCTCCTCGCGTCACTCCTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3666414-3666686	Sequence	METDI3725 - hypothetical protein (Protein is coded in complementary strand; from 3666686 to 3666414)