Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 3534442
End position: 3534477
Length: 36

DNA sequence
>NC_012988, from 3534442 to 3534477 (36 bp); Methylobacterium extorquens DM4 CCCGGCATGGGGGCTGGCATGGGGACCAGCATGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3534407-3535162	Sequence	METDI3595 cynT carbonic anhydrase (Protein is coded in complementary strand; from 3535162 to 3534407)