Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2314499
End position: 2314534
Length: 36

DNA sequence
>NC_012988, from 2314499 to 2314534 (36 bp); Methylobacterium extorquens DM4 TGGCCGAAGGGTGGGCCGAAGGGTTGGCCGATGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2313619-2314557	Sequence	METDI2394 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 2314557 to 2313619)