Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2037652
End position: 2037687
Length: 36

DNA sequence
>NC_012988, from 2037652 to 2037687 (36 bp); Methylobacterium extorquens DM4 CTCTGCCGGTGGCTCTGCCGATGATCCTGCCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2036671-2037696	Sequence	METDI2151 - cation efflux system protein (Protein is coded in complementary strand; from 2037696 to 2036671)