Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1952885
End position: 1952920
Length: 36

DNA sequence
>NC_012988, from 1952885 to 1952920 (36 bp); Methylobacterium extorquens DM4 GCCCCATCCTTGGCCCCGTCCTTGGCGCCGTCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1952261-1953844	Sequence	METDI2066 cycH cytochrome C-type biogenesis protein CycH (Protein is coded in complementary strand; from 1953844 to 1952261)