Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1001209
End position: 1001244
Length: 36

DNA sequence
>NC_012988, from 1001209 to 1001244 (36 bp); Methylobacterium extorquens DM4 GATCACAGCCATGACCACAGCCATGAGCACGGCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1001212-1001592	Sequence	METDI1090 - hypothetical protein (Protein is coded in complementary strand; from 1001592 to 1001212)