Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2276630
End position: 2276661
Length: 32

DNA sequence
>NC_012988, from 2276630 to 2276661 (32 bp); Methylobacterium extorquens DM4 CCGGCCGCCCAGCCGCCCAGCCGCCCGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2276398-2276727	Sequence	METDI2361 - hypothetical protein (Protein is coded in complementary strand; from 2276727 to 2276398)