Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 582449
End position: 582478
Length: 30

DNA sequence
>NC_012988, from 582449 to 582478 (30 bp); Methylobacterium extorquens DM4 GGCCTCGCCCTCGGTCTCGCCCTCCGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 582156-582857	Sequence	METDI0615 - Two-component response regulator (Protein is coded in complementary strand; from 582857 to 582156)