Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5804319
End position: 5804348
Length: 30

DNA sequence
>NC_012988, from 5804319 to 5804348 (30 bp); Methylobacterium extorquens DM4 TTGGCCTTGGCGTCGGCCTTCGCCTTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5803614-5805029	Sequence	METDI5816 tolA TolA-TolQ-TolR complex membrane anchored protein (Protein is coded in complementary strand; from 5805029 to 5803614)