Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4700670
End position: 4700699
Length: 30

DNA sequence
>NC_012988, from 4700670 to 4700699 (30 bp); Methylobacterium extorquens DM4 CCACCGCCTCCGCCTCCGCCTCCGCCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4700513-4700710	Sequence	METDI4810 - hypothetical protein (Protein is coded in complementary strand; from 4700710 to 4700513)