Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 3234801
End position: 3234830
Length: 30

DNA sequence
>NC_012988, from 3234801 to 3234830 (30 bp); Methylobacterium extorquens DM4 GCGCCGCCCGGCGCAGCTCGCCGCCGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3234230-3235921	Sequence	METDI3300 - hypothetical protein (Protein is coded in complementary strand; from 3235921 to 3234230)