Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 211034
End position: 211063
Length: 30

DNA sequence
>NC_012988, from 211034 to 211063 (30 bp); Methylobacterium extorquens DM4 CGAGGCTGAGGCCCAGGCCGAAGCCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 210937-212367	Sequence	METDI0205 - sensor histidine kinase; membrane protein (Protein is coded in complementary strand; from 212367 to 210937)