Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2006929
End position: 2006958
Length: 30

DNA sequence
>NC_012988, from 2006929 to 2006958 (30 bp); Methylobacterium extorquens DM4 GCCAGCGCCAGCCCCAGCACCAGCGCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2006407-2007321	Sequence	METDI2121 - hypothetical protein (Protein is coded in complementary strand; from 2007321 to 2006407)