Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1791084
End position: 1791113
Length: 30

DNA sequence
>NC_012988, from 1791084 to 1791113 (30 bp); Methylobacterium extorquens DM4 CAGCCGTAGCCGTAGCCGTAGCCGTAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1791081-1791554	Sequence	METDI1912 - hypothetical protein (Protein is coded in complementary strand; from 1791554 to 1791081)