Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1125628
End position: 1125657
Length: 30

DNA sequence
>NC_012988, from 1125628 to 1125657 (30 bp); Methylobacterium extorquens DM4 GCTGGTGCTGGTGCGGGTGCGGGTGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1125530-1126027	Sequence	METDI1228 - hypothetical protein (Protein is coded in complementary strand; from 1126027 to 1125530)