Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5853643
End position: 5853669
Length: 27

DNA sequence
>NC_012988, from 5853643 to 5853669 (27 bp); Methylobacterium extorquens DM4 GTGGCGAGCGCGGCGAGCGTCGCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5853520-5854329	Sequence	METDI5862 - hypothetical protein (Protein is coded in complementary strand; from 5854329 to 5853520)