Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5439512
End position: 5439538
Length: 27

DNA sequence
>NC_012988, from 5439512 to 5439538 (27 bp); Methylobacterium extorquens DM4 CCGCTCCGGCCGCACCGGCCGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5438530-5440236	Sequence	METDI5486 - ATP-independent RNA helicase, DEAD/DEAH-box family protein