Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5052456
End position: 5052482
Length: 27

DNA sequence
>NC_012988, from 5052456 to 5052482 (27 bp); Methylobacterium extorquens DM4 CTCGCCCGGCTCGCCCAGCGCGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5051896-5053263	Sequence	METDI5128 - OMA family outer membrane saccharide export protein