Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 634243
End position: 634267
Length: 25

DNA sequence
>NC_012988, from 634243 to 634267 (25 bp); Methylobacterium extorquens DM4 CCCGGCCCAGGCCGGCCCGGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 634020-634541	Sequence	METDI0668 flbT flagellum biosynthesis repressor protein FlbT