Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5107677
End position: 5107701
Length: 25

DNA sequence
>NC_012988, from 5107677 to 5107701 (25 bp); Methylobacterium extorquens DM4 GGGCCGGGGCGGGCAGCGCCGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5107637-5109205	Sequence	METDI5188 metG methionyl-tRNA synthetase (Protein is coded in complementary strand; from 5109205 to 5107637)