Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4594673
End position: 4594697
Length: 25

DNA sequence
>NC_012988, from 4594673 to 4594697 (25 bp); Methylobacterium extorquens DM4 GTGGCGAGGCGGGGCGGGGCGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4594151-4595371	Sequence	METDI4708 - electron transfer flavoprotein subunit alpha (Protein is coded in complementary strand; from 4595371 to 4594151)