Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4287326
End position: 4287350
Length: 25

DNA sequence
>NC_012988, from 4287326 to 4287350 (25 bp); Methylobacterium extorquens DM4 CGGCGGGGCGGGGCGCGGGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4287231-4288061	Sequence	METDI4362 - hypothetical protein (Protein is coded in complementary strand; from 4288061 to 4287231)