Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 89457
End position: 89480
Length: 24

DNA sequence
>NC_012988, from 89457 to 89480 (24 bp); Methylobacterium extorquens DM4 TCAGGCGCAGGCTCCGGCGCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 89429-90385	Sequence	METDI0089 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 90385 to 89429)