Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 69311
End position: 69334
Length: 24

DNA sequence
>NC_012988, from 69311 to 69334 (24 bp); Methylobacterium extorquens DM4 GCGGTCTCGGTCGCGGTGGCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 68597-70294	Sequence	METDI0072 - methyl-accepting chemotaxis receptor/sensory transducer (Protein is coded in complementary strand; from 70294 to 68597)