Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5788130
End position: 5788153
Length: 24

DNA sequence
>NC_012988, from 5788130 to 5788153 (24 bp); Methylobacterium extorquens DM4 TTGACCTTGTCCTTGAACTGGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5787920-5788474	Sequence	METDI5801 - hypothetical protein (Protein is coded in complementary strand; from 5788474 to 5787920)