Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5771139
End position: 5771162
Length: 24

DNA sequence
>NC_012988, from 5771139 to 5771162 (24 bp); Methylobacterium extorquens DM4 GCCATCGCCATCGCCACCGCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5770519-5771481	Sequence	METDI5784 accA acetyl-CoA carboxylase, carboxytransferase subunit alpha