Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5669054
End position: 5669077
Length: 24

DNA sequence
>NC_012988, from 5669054 to 5669077 (24 bp); Methylobacterium extorquens DM4 GAGCCGGTGCCGGAGCCGGAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5667786-5669678	Sequence	METDI5684 - glutathione-regulated potassium-efflux system protein