Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5642820
End position: 5642843
Length: 24

DNA sequence
>NC_012988, from 5642820 to 5642843 (24 bp); Methylobacterium extorquens DM4 GCCAGCGCCATCGCCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5642610-5642894	Sequence	METDI5664 - pH adaptation potassium efflux system protein PhaF (Protein is coded in complementary strand; from 5642894 to 5642610)