Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5579424
End position: 5579447
Length: 24

DNA sequence
>NC_012988, from 5579424 to 5579447 (24 bp); Methylobacterium extorquens DM4 CCGACGCCGATGACGACGCCGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5578197-5580236	Sequence	METDI5610 - hypothetical protein (Protein is coded in complementary strand; from 5580236 to 5578197)